View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2035_high_13 (Length: 254)

Name: NF2035_high_13
Description: NF2035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2035_high_13
NF2035_high_13
[»] chr3 (1 HSPs)
chr3 (18-254)||(21829813-21830049)


Alignment Details
Target: chr3 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 18 - 254
Target Start/End: Complemental strand, 21830049 - 21829813
Alignment:
18 ttctaagggagatcatcttcatacgaggaaatctcataagataatgacctgcaatgggaacgtctcaatggagaattgtcatcattacaacaaactccat 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||    
21830049 ttctaagggagatcatcttcatacgaggaaatctcataagataatgacctgcaataggaacgtctcaatggagaattttcatcattacaacaaactccat 21829950  T
118 gccccataggagcgaggggagggagggttggaggtttcatatagtatttaacattatggcgttgaggggactaggacggtggacgatgatgggggtctta 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21829949 gccccataggagcgaggggagggagggttggaggtttcatatagtatttaacattatggcgttgaggggactaggacggtggacgatgatgggggtctta 21829850  T
218 gactctaaatctttcggggacaaaaaatgtcgtgtct 254  Q
    |||| ||||||||||||||||||||||||||||||||    
21829849 gactttaaatctttcggggacaaaaaatgtcgtgtct 21829813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University