View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2035_high_5 (Length: 376)
Name: NF2035_high_5
Description: NF2035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2035_high_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 160 - 352
Target Start/End: Original strand, 7760410 - 7760602
Alignment:
| Q |
160 |
tcaagttcagagtaaccaagtccatcatcacctttctgatttatcattacaccgacaagcaacgtatggacaatttcaaatgcggttgtttatagggatc |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7760410 |
tcaagttcagagtaaccaagtccatcatcacctttctgatttatcattacaccgacaagcaacgtatggacaatttcaaatgcggttgtttataaggatc |
7760509 |
T |
|
| Q |
260 |
agaaggttctggcttactatgaaatgtcattttcctttaatcctgaaaccgtcttcttcctccatcttttcttagccaaacaatatctaggtt |
352 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7760510 |
agaaggttctggcttactatgaaatgtcattttcctttaatcctgaaaccgtcttcttcctccatcttttcttagccaaacaatatctaggtt |
7760602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 6 - 119
Target Start/End: Original strand, 7760255 - 7760368
Alignment:
| Q |
6 |
agaaccgaaatcataagatttctgaaagtttccgacactgtgaacaggaaatagttccctgaatatcaaaggaagaacattgcaagacgagcaatttcca |
105 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7760255 |
agaaccgaaatcataagatttctgaaggtttccgacactgtcaacaggaaatagttccctgaatatcaaaggaagaacattgcaagatgagcaatttcca |
7760354 |
T |
|
| Q |
106 |
cagcaatatgtttt |
119 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
7760355 |
cagcaatatgtttt |
7760368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 76 - 118
Target Start/End: Original strand, 10268828 - 10268870
Alignment:
| Q |
76 |
ggaagaacattgcaagacgagcaatttccacagcaatatgttt |
118 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
10268828 |
ggaagaacattgcaagacaagcaatttccacggcaatatgttt |
10268870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University