View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2035_high_7 (Length: 300)
Name: NF2035_high_7
Description: NF2035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2035_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 53 - 290
Target Start/End: Complemental strand, 35317114 - 35316883
Alignment:
| Q |
53 |
agtatgtgattattgatcaaattatagaaagtaggctcaggcatgatgcaagagtaatctatttgtttatgtttatgtttatgttagacaaaaacagtat |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
35317114 |
agtatgtgattattgatcaaattatagaaagtaggctcatgcatgatgcaagagtaatctatttgtttatgtttatgtt------agacaaaaacagtat |
35317021 |
T |
 |
| Q |
153 |
ataccttttgttcaaaaatagtgctccccctttatcaagaatacagtatggaatgtaatactggaagacataagaaaacaaatgactcgaattgtcatcc |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35317020 |
ataccttttgttcaaaaatagtgctccccctttatcaagagtacagtatggaatgcaatactggaagacataagaaaacaaatgactcgaattgtcatcc |
35316921 |
T |
 |
| Q |
253 |
gttactggtggtgccgctactagatcctaatccctatg |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35316920 |
gttactggtggtgccgctactagatcctaatccttatg |
35316883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University