View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20360_high_11 (Length: 251)
Name: NF20360_high_11
Description: NF20360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20360_high_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 87 - 244
Target Start/End: Original strand, 37183435 - 37183592
Alignment:
| Q |
87 |
ctgttattgtctgttttctcttttagcataacaaacttcttcataatctgccttgcgtcaagtgcctcaactagccttgtgcgaagccattcaacctcca |
186 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37183435 |
ctgttatcgtctgttttctcttttagcataacaaacttcttcataatctcccttgcgtcaagtgcctcaactagccttgtgcgaagccattcaacctcca |
37183534 |
T |
 |
| Q |
187 |
ctttcatgctttttatttcatcaacctgatcaatcttggttttcaggacttcttctct |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37183535 |
ctttcatgctttttatttcatcaacctgatcaatcttggttttcaggacttcttctct |
37183592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 87 - 244
Target Start/End: Original strand, 37194567 - 37194724
Alignment:
| Q |
87 |
ctgttattgtctgttttctcttttagcataacaaacttcttcataatctgccttgcgtcaagtgcctcaactagccttgtgcgaagccattcaacctcca |
186 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37194567 |
ctgttatcgtctgttttctcttttagcataacaaacttcttcataatctcccttgcgtcaagtgcctcaactagccttgtgcgaagccattcaacctcca |
37194666 |
T |
 |
| Q |
187 |
ctttcatgctttttatttcatcaacctgatcaatcttggttttcaggacttcttctct |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37194667 |
ctttcatgctttttatttcatcaacctgatcaatcttggttttcaggacttcttctct |
37194724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University