View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20360_low_14 (Length: 234)
Name: NF20360_low_14
Description: NF20360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20360_low_14 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 110 - 213
Target Start/End: Complemental strand, 31788613 - 31788511
Alignment:
| Q |
110 |
acttcacgttattttttgtttgtgaagaagaaattataacaatgtctcaatatcaacaaggttatggtgatcaaacacgtagggttgatgaatatggaaa |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31788613 |
acttcacgttattttttgtttgtgaagaagaa-ttataacaatgtctcaatatcaacaaggttatggtgatcaaacacgtagggttgatgaatatggaaa |
31788515 |
T |
|
| Q |
210 |
ccca |
213 |
Q |
| |
|
|||| |
|
|
| T |
31788514 |
ccca |
31788511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University