View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20360_low_8 (Length: 466)
Name: NF20360_low_8
Description: NF20360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20360_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 374; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 374; E-Value: 0
Query Start/End: Original strand, 18 - 453
Target Start/End: Complemental strand, 4075372 - 4074936
Alignment:
| Q |
18 |
catctatctataggaagcaatgggagcctttaacagaagagcaaatatcaaatccaaaatcttatgcagattgcatacattggtgtctccctggtgtgcc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4075372 |
catctatctataggaagcaatgggagcctctaacagaagagcaaatatcaaatccaaaatcttatgcagattgcatacattggtgtctccctggtgtgcc |
4075273 |
T |
 |
| Q |
118 |
tgatacttggaatgagcttctttatgcctatattttccatagatgacaaacatttgatattgaaaactttaagtacaatacgttacatttatgtttggtt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| ||||||||||| ||||||| |
|
|
| T |
4075272 |
tgatacttggaatgagcttctttatgcctatattttccatagatgacaaacatttgatattgaaaacttgaagtaaaatatgttacatttatctttggtt |
4075173 |
T |
 |
| Q |
218 |
tggtttgttatcttgttttctcttgatgttgactgaggtgagggaagttgaagtgtaaagaatattgttatccctaatccttaaaaaacatgcatatgct |
317 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4075172 |
tgttttgttatcttgttttctcttgatgttgactgaggtgagggaagttgaagtgtaaagaatattgttatccctaatccttaaaaaacatgcatatgct |
4075073 |
T |
 |
| Q |
318 |
agtg-nnnnnnnnnaatgtcatgtatctttttcatcacaatgatacttgtttaccttattaaacaaaaaattagacctagtttcaagctgaatgacataa |
416 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4075072 |
agtgttttttttttaatgtcatgtatctttttcatcacaatgatacttgtttaccttattaaacaaaaaattagacctagtttcaagctgaatgacataa |
4074973 |
T |
 |
| Q |
417 |
aagtaatggcgacagtagttagatccaaaatattctt |
453 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4074972 |
aagtaatggcgacagtagttggatccaaaatattctt |
4074936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 81 - 130
Target Start/End: Original strand, 5232904 - 5232953
Alignment:
| Q |
81 |
atgcagattgcatacattggtgtctccctggtgtgcctgatacttggaat |
130 |
Q |
| |
|
|||| ||||| |||||||||||| | |||||||| ||||||||||||||| |
|
|
| T |
5232904 |
atgctgattgtatacattggtgtttgcctggtgttcctgatacttggaat |
5232953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 59; Significance: 8e-25; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 20 - 154
Target Start/End: Original strand, 25824790 - 25824924
Alignment:
| Q |
20 |
tctatctataggaagcaatgggagcctttaacagaagagcaaatatcaaatccaaaatcttatgcagattgcatacattggtgtctccctggtgtgcctg |
119 |
Q |
| |
|
|||||||||||||| || ||||| ||| |||| |||| || |||||||||||||| |||||||||||||||||||||||| || || || || |||| |
|
|
| T |
25824790 |
tctatctataggaaacagtgggaacctctaactcaagaacagatatcaaatccaaatggttatgcagattgcatacattggtgcctaccaggagttcctg |
25824889 |
T |
 |
| Q |
120 |
atacttggaatgagcttctttatgcctatattttc |
154 |
Q |
| |
|
|| |||||||||||||||||||||||||||||| |
|
|
| T |
25824890 |
atgtatggaatgagcttctttatgcctatattttc |
25824924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 95 - 144
Target Start/End: Original strand, 37804102 - 37804151
Alignment:
| Q |
95 |
cattggtgtctccctggtgtgcctgatacttggaatgagcttctttatgc |
144 |
Q |
| |
|
|||||||||||||||||||| || ||| | ||||||||| |||||||||| |
|
|
| T |
37804102 |
cattggtgtctccctggtgttcccgattcgtggaatgagattctttatgc |
37804151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.00000001; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 86 - 133
Target Start/End: Complemental strand, 19411880 - 19411833
Alignment:
| Q |
86 |
gattgcatacattggtgtctccctggtgtgcctgatacttggaatgag |
133 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
19411880 |
gattgcagtcattggtgcctccctggtgtgcctgatatttggaatgag |
19411833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 86 - 133
Target Start/End: Complemental strand, 50750203 - 50750156
Alignment:
| Q |
86 |
gattgcatacattggtgtctccctggtgtgcctgatacttggaatgag |
133 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
50750203 |
gattgcagccattggtgcctccctggtgtgcctgatatttggaatgag |
50750156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000004; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 98 - 144
Target Start/End: Original strand, 7821871 - 7821917
Alignment:
| Q |
98 |
tggtgtctccctggtgtgcctgatacttggaatgagcttctttatgc |
144 |
Q |
| |
|
|||||||| |||||||| |||||||| ||||||||||| |||||||| |
|
|
| T |
7821871 |
tggtgtcttcctggtgtacctgatacatggaatgagctactttatgc |
7821917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 95 - 144
Target Start/End: Original strand, 7812337 - 7812386
Alignment:
| Q |
95 |
cattggtgtctccctggtgtgcctgatacttggaatgagcttctttatgc |
144 |
Q |
| |
|
||||||||||| || ||||| |||||||| ||||||||||| |||||||| |
|
|
| T |
7812337 |
cattggtgtcttcccggtgtacctgatacatggaatgagctactttatgc |
7812386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 86 - 130
Target Start/End: Original strand, 15113355 - 15113399
Alignment:
| Q |
86 |
gattgcatacattggtgtctccctggtgtgcctgatacttggaat |
130 |
Q |
| |
|
||||||| ||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
15113355 |
gattgcagccattggtgtctgcctggtgttcctgatacttggaat |
15113399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 84 - 132
Target Start/End: Original strand, 25962716 - 25962764
Alignment:
| Q |
84 |
cagattgcatacattggtgtctccctggtgtgcctgatacttggaatga |
132 |
Q |
| |
|
||||||||| ||||||||||| |||||| | ||||||||||||||||| |
|
|
| T |
25962716 |
cagattgcagtcattggtgtcttcctggtttacctgatacttggaatga |
25962764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University