View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20361_high_1 (Length: 423)
Name: NF20361_high_1
Description: NF20361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20361_high_1 |
 |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0001 (Bit Score: 388; Significance: 0; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 388; E-Value: 0
Query Start/End: Original strand, 1 - 404
Target Start/End: Original strand, 143069 - 143472
Alignment:
| Q |
1 |
ggctttgcatccaaacaagagcacctcacaaaatctatttgccttgatgcaaaatattagcagttattagattccattgtttagcgttatgttatggagt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
143069 |
ggctttgcatccaaacaagagcacctcacaaaatctatttgccgtgatgcaaaatattagcagttattagattccattgtttagcgttatgttatggagt |
143168 |
T |
 |
| Q |
101 |
atttggaagaataggaacccgaaaatttggaatgatgtcaactaagttgtcaagtgatttgtaaaagaggatgttctttgttcactacatggcaaatgct |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
143169 |
atttggaaaaataggaacccgaaaatttggaatgatgtcaactaagttgtcaagtgatttgtaaaagaggatgttctttgttcactacatggcaaatgct |
143268 |
T |
 |
| Q |
201 |
caagaagctaagtataactttaaccatataaatacaatgttgatgcttcattctcccattctctcaatatagttggaattggaattagcatatctaagat |
300 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
143269 |
caagaagctaagtgtaactttaaccatataaatacaatgttgatgcttcattctcccattctctcaatatagttggaattggaattagcatatctaagat |
143368 |
T |
 |
| Q |
301 |
gttcgggggagttttattctagccaaaactaagtggatttcccctgtgcttgaggttgacacagaccaaagcactgagaatcttatatgctttaaagtgg |
400 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
143369 |
gttcgggggagttttgttctagccaaaactaagtggatttcccctgtgcttgaggttgacacagaccaaagcactgagaatcttatatgctttaaagtgg |
143468 |
T |
 |
| Q |
401 |
gtga |
404 |
Q |
| |
|
|||| |
|
|
| T |
143469 |
gtga |
143472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University