View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20361_high_9 (Length: 223)
Name: NF20361_high_9
Description: NF20361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20361_high_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 19 - 208
Target Start/End: Original strand, 19267563 - 19267757
Alignment:
| Q |
19 |
gaatatctatgaaagaaagacgagaaaagaagcactt------tacaccggtgcaacttgctccaaatgaagaagaagatccataagatattgatcccat |
112 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
19267563 |
gaatatctctgaaagaaagacgagaaa-gaagcacttattaattacaccggtgcaacttgctccaa-tgaagaagaagatccataagatattgatcccat |
19267660 |
T |
|
| Q |
113 |
at--ccaaaagacgcatgcttttcagcaagtcctctttctcttgttttattttgatgatagttaatgctttaaattcaccatcttcttctgttgttcc |
208 |
Q |
| |
|
|| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| | ||| |||||||||||||||||||||||||||||| |
|
|
| T |
19267661 |
atatccaaaagacacatgcttttcagcaagtcctctttctcttgttttattttgatgatag-tgatgttttaaattcaccatcttcttctgttgttcc |
19267757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University