View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20361_low_8 (Length: 237)
Name: NF20361_low_8
Description: NF20361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20361_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 4e-71; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 1 - 144
Target Start/End: Original strand, 30550135 - 30550278
Alignment:
| Q |
1 |
ttttatttcttgaatcatttagttcataggtcgactatttaaataataaaatttaacttaagtgttgaacatgtatatttagttggaatataactcagtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30550135 |
ttttatttcttgaatcatttagttcataggtcgattatttaaataataaaatttaaattaagtgttgaacatgtatatttagttggaatataactcagtg |
30550234 |
T |
 |
| Q |
101 |
gttttgctttgacataaaataatcaaatgataagtttggaaaaa |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30550235 |
gttttgctttgacataaaataatcaaatgataagtttggaaaaa |
30550278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 163 - 222
Target Start/End: Original strand, 30550268 - 30550327
Alignment:
| Q |
163 |
gtttggaaaaataagccaaacatgactcattttcactcctacctaatccctcgagagaat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
30550268 |
gtttggaaaaataagccaaacatgactcatgttcactcctacctaatccctcgagagaat |
30550327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University