View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20362_low_37 (Length: 286)

Name: NF20362_low_37
Description: NF20362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20362_low_37
NF20362_low_37
[»] chr1 (1 HSPs)
chr1 (18-258)||(2282889-2283129)


Alignment Details
Target: chr1 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 18 - 258
Target Start/End: Complemental strand, 2283129 - 2282889
Alignment:
18 gtttagtgatgtagagatgtaacttaccatcaatgagtgattgggagacatggaaggtggaacataagagcagggacagaaacaagaagacattcatggt 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2283129 gtttagtgatgtagagatgtaacttaccatcaatgagtgattgggagacatggaaggtggaacataagagcagggacagaaacaagaagacattcatggt 2283030  T
118 ggttgagctatgaaagttactgctcttcattcaagtttgagaggaggatatggtatggggaaagaagaaggcgcgagaatgaaatggacttagcaagcaa 217  Q
    ||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2283029 ggttgagctatgaaagttactactcttcattcaagtttgagaagaggatatggtatggggaaagaagaaggcgcgagaatgaaatggacttagcaagcaa 2282930  T
218 tgttacagggtacaggatgggcatgtccttatatgcatgct 258  Q
    |||||||||||||||||||||||||||||||||||||||||    
2282929 tgttacagggtacaggatgggcatgtccttatatgcatgct 2282889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University