View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20362_low_39 (Length: 267)
Name: NF20362_low_39
Description: NF20362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20362_low_39 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 19 - 254
Target Start/End: Complemental strand, 45556100 - 45555865
Alignment:
| Q |
19 |
gcactcctattcattgaatagaattgaatgttgctgctactgcctgctgatgacgacttggtgtattgcagccatcgctattgctatgtgaagcctgtgg |
118 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45556100 |
gcactcctattcatcgaatagaattgaatgttgctgctactgcctgctgatgacgacttggtttattgcagccattgctattgctatgtgaagcctgtgg |
45556001 |
T |
 |
| Q |
119 |
aacaaagaaggaaaaagatgttttaaagtttaaagtttggtcttgcaaattttgtactctagaaaacaatatcaagcttgatagatgcttagcttgtgga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45556000 |
aacaaagaaggaaaaagatgttttaaagtttaaagtttggtcttgcaaattttgtactctagaaaacaatatcaagcttgatagatgcttagcttgtgga |
45555901 |
T |
 |
| Q |
219 |
gaatggagattttcacatggtccactcgtctcccct |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
45555900 |
gaatggagattttcacatggtccactcgtctcccct |
45555865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University