View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20362_low_40 (Length: 251)
Name: NF20362_low_40
Description: NF20362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20362_low_40 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 13 - 114
Target Start/End: Original strand, 20473618 - 20473716
Alignment:
| Q |
13 |
cagagagtatgaggccattaataataatacctcttttctgcaaagtttctctagtgggtaatttgtcttgaagaatctcgaaccaaagatactaatgttt |
112 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20473618 |
cagagagcatgaggccattaat---aatacctcttttctgcaaagcttctctagtgggtaatttgtcttgaagaatctcgaaccaaagatactaatgttt |
20473714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 219 - 249
Target Start/End: Original strand, 20473712 - 20473742
Alignment:
| Q |
219 |
tttatataataaatgttttgtaaaattttag |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
20473712 |
tttatataataaatgttttgtaaaattttag |
20473742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University