View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20364_low_16 (Length: 274)
Name: NF20364_low_16
Description: NF20364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20364_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 108 - 261
Target Start/End: Complemental strand, 25628335 - 25628180
Alignment:
| Q |
108 |
cacataatcttctctaaagaaggtgcaatataaaagctaaacttttcaaagattttctgtatatatccatatggctagaagtggacgtaacggttcatgc |
207 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25628335 |
cacataatcttttctaaagaaggtgcaatataaaagctaaacttttcaaagattttctgtatatatccatatggctagaagtggacgtaacggttcatgc |
25628236 |
T |
 |
| Q |
208 |
ttgatcaacccttgtttatgccacctttcag--ttcagtctttcattggccatggt |
261 |
Q |
| |
|
| ||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25628235 |
tcgatcaacccttgtttatgccacctttcagttttcagtctttcattggccatggt |
25628180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 120 - 164
Target Start/End: Complemental strand, 31206575 - 31206531
Alignment:
| Q |
120 |
tctaaagaaggtgcaatataaaagctaaacttttcaaagattttc |
164 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
31206575 |
tctaaagaaggtccaatataaaagctaaacttttcaaagattttc |
31206531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University