View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20364_low_23 (Length: 232)
Name: NF20364_low_23
Description: NF20364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20364_low_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 18 - 219
Target Start/End: Original strand, 26949218 - 26949420
Alignment:
| Q |
18 |
tagggttgatttatgnnnnnnnaccacacactcatacactttctattcaattattttctannnnnnnnnaatgtatgtgctataaatgatattgatagta |
117 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
26949218 |
tagggttgatttatgccccccgaccacacactcatacactttctattcaattattttctatttttttttaatgtgtgtgctataaatgatattgatagta |
26949317 |
T |
|
| Q |
118 |
tctttagatccaactaatcgagatcatcactatctttataagac-aaaaatattaaacacccctaaattttatacacttattcaacatattattctctct |
216 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26949318 |
tctttagatccaactaattgagatcatcactatctttataagacaaaaaatattaaacacccctaaattttatacacttattcaacatattattctctct |
26949417 |
T |
|
| Q |
217 |
tta |
219 |
Q |
| |
|
||| |
|
|
| T |
26949418 |
tta |
26949420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 180 - 224
Target Start/End: Complemental strand, 36424744 - 36424700
Alignment:
| Q |
180 |
taaattttatacacttattcaacatattattctctctttagttct |
224 |
Q |
| |
|
||||||||||||||||||| ||||| ||||| |||||||| |||| |
|
|
| T |
36424744 |
taaattttatacacttatttaacattttattttctctttatttct |
36424700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University