View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20365_high_28 (Length: 313)
Name: NF20365_high_28
Description: NF20365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20365_high_28 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 19 - 306
Target Start/End: Complemental strand, 2243645 - 2243359
Alignment:
| Q |
19 |
cttgtgtgattgtattgcaatcttaccatgattttgcacattttcgattatacaatcgattttacgattttgaaaactacggggtggaggaaatgcataa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2243645 |
cttgtgtgattgtattgcaatcttaccatgattttgcacattttcgattatacaatcgattttacgattttgaaaactatggggtggaggaaatgcataa |
2243546 |
T |
 |
| Q |
119 |
gagaggctcttgaacaacgattaaaggcttcttctatatgatgtaaggtaacattcagannnnnnngccaaaaagttacgaatatccaccggttttttct |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
2243545 |
gagaggctcttgaacaacgattaaaggcttcttctatatgatgtaaggtaacattcatatttttttgccaaaaagttacgaatatccaccggttttttct |
2243446 |
T |
 |
| Q |
219 |
acataactccttgatgattgggggtaatgtaggcctcacctatagagnnnnnnncttcttcttttaattagttaccattttcatctca |
306 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
2243445 |
acataaccccttgatgattgggggtaatgtaggcctcacctatagagttgtttt-ttcttcttacaattagttaccattttcatctca |
2243359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University