View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20365_high_32 (Length: 303)
Name: NF20365_high_32
Description: NF20365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20365_high_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 7 - 290
Target Start/End: Complemental strand, 37526110 - 37525817
Alignment:
| Q |
7 |
atgaagatgataaagaaaggggccctgagagtgaggtgttgtacgtaaaaga----------gagtgagggagatgcttttttcatttacttgaattgaa |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37526110 |
atgaagatgataaagaaaggggccctgagagtgaggtgttgtacgtaaaagaaagagtgagggagagagggagatgcttttttcatttacttgaattgaa |
37526011 |
T |
 |
| Q |
97 |
ttgaaatgaaaggcaaataataacacaaatactacataacagtggtggcaatcatgttgacaagaccactgcacctcttttatgcagactacagagcttg |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37526010 |
ttgaaatgaaaggcaaataataacacaaatactacataacagtggtggcaatcatgttgacaagaccactgcacctcttttatgcagactacagagcttg |
37525911 |
T |
 |
| Q |
197 |
catccgtcatccacgaccctactacactatcaatgtgccgtgactgtagacagttttcactgtctcttcttatttgaggtctaaccattgttgt |
290 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37525910 |
catccgtcatccacgaccctactactctatcattgtgccgtgactgtagacagttttcactgtctcttcttatttgaggtctaaccattgttgt |
37525817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University