View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20365_high_51 (Length: 221)
Name: NF20365_high_51
Description: NF20365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20365_high_51 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 48 - 208
Target Start/End: Complemental strand, 1065222 - 1065062
Alignment:
| Q |
48 |
ttgttcatgaacgtgcatcaactgctagaaacattcaattttagaagctgaacctccaaatctttatttcttgatcattctcgtaaacaccttcagactt |
147 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1065222 |
ttgttcatgaacgtgcatcaaccgctagaaacattcaattttagaagctgcacctccaaatctttatttcttgatcattctcgtaaaccccttcagactt |
1065123 |
T |
 |
| Q |
148 |
attccgtgtttctttctttcgacacaagtcctaccatggcttttgactggcaatcagaatt |
208 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
1065122 |
attccgcgtttctttctttctacacaagtcctgccatggcttttgattggcaatcagaatt |
1065062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University