View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20365_high_9 (Length: 458)
Name: NF20365_high_9
Description: NF20365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20365_high_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 153; Significance: 6e-81; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 153; E-Value: 6e-81
Query Start/End: Original strand, 1 - 178
Target Start/End: Original strand, 21733159 - 21733338
Alignment:
| Q |
1 |
acgagtttataatgaagctttctcttttgatcattttctttttgtctctcctaattagctcttctagcagtgagtttcttctcttctattgcatattatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21733159 |
acgagtttataatgaagctttctcttttgatccttttctttttgtctctcctaattagctcttctagcagtgagtttcttctcttctattgcatattatt |
21733258 |
T |
|
| Q |
101 |
cttcttc--ttttttggtacataaaacatacattttaatgcaagtcttaatatattttgatgtaaatcatggagcatttt |
178 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
21733259 |
cttcttcttttttttcatacataaaacatacattttaatgcaagtcttaatatattttgatgtaaatcatggatcatttt |
21733338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 271 - 440
Target Start/End: Original strand, 21733441 - 21733610
Alignment:
| Q |
271 |
aatgaatataatattgatgattgttgtttgtttttcctctacaggtgtgatagcaccagtgaagccccccattgaagcactatcatgtgacccaaacaaa |
370 |
Q |
| |
|
||||||||||||||| ||||||||| ||| ||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
21733441 |
aatgaatataatatttatgattgttctttatttttcctctacaggtgtgatagcacctgtgaagcccctagttgaagcactatcatgtgacccaaacaag |
21733540 |
T |
|
| Q |
371 |
cctggaattatccgtatttggttttgcaaacatagggagtgtcatacaaaatgttttgctaaatatggtt |
440 |
Q |
| |
|
|||||||||||||||||||||||||||||| || ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
21733541 |
cctggaattatccgtatttggttttgcaaagatgaggagtgtcatagaaaatgttttgctaaatatggtt |
21733610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 1 - 100
Target Start/End: Original strand, 21741660 - 21741759
Alignment:
| Q |
1 |
acgagtttataatgaagctttctcttttgatcattttctttttgtctctcctaattagctcttctagcagtgagtttcttctcttctattgcatattatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21741660 |
acgagtttataatgaagctttctcttttgatccttttctttttgtctctcctcattagctcttctagcagtgagtttcttctcttctattgcatattatt |
21741759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 297 - 437
Target Start/End: Original strand, 21749932 - 21750078
Alignment:
| Q |
297 |
tttgtttttcctctacaggtgtgatagcaccagtgaagccccccattgaagcactatcatgtgacccaaacaaacc------tggaattatccgtatttg |
390 |
Q |
| |
|
||||||||| ||||| |||||||| |||| | | ||||||||| ||||||||||||||||||||||||||||| || ||||||||| || ||||| |
|
|
| T |
21749932 |
tttgtttttactctaaaggtgtgacagcatctgagaagccccctattgaagcactatcatgtgacccaaacaagcctgaaattggaattattcgcatttg |
21750031 |
T |
|
| Q |
391 |
gttttgcaaacatagggagtgtcatacaaaatgttttgctaaatatg |
437 |
Q |
| |
|
||||||||||||| |||||| |||| | | |||||||||||||||| |
|
|
| T |
21750032 |
gttttgcaaacatgaggagtgccatagacagtgttttgctaaatatg |
21750078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 12 - 92
Target Start/End: Original strand, 21748683 - 21748763
Alignment:
| Q |
12 |
atgaagctttctcttttgatcattttctttttgtctctcctaattagctcttctagcagtgagtttcttctcttctattgc |
92 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||||| ||||||| || ||||||||| |||||||||||||||| |
|
|
| T |
21748683 |
atgaagctatctcttttgatcattttctttgtgtctctcctggttagctcatcgtgcagtgagtatcttctcttctattgc |
21748763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 44; Significance: 7e-16; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 5 - 72
Target Start/End: Complemental strand, 30148120 - 30148053
Alignment:
| Q |
5 |
gtttataatgaagctttctcttttgatcattttctttttgtctctcctaattagctcttctagcagtg |
72 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| | |||||| |||||||||||| || ||||||| |
|
|
| T |
30148120 |
gtttataatgaagctttctattttgatcattttctctgtgtctcccctaattagctcatcaagcagtg |
30148053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University