View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20365_low_24 (Length: 345)
Name: NF20365_low_24
Description: NF20365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20365_low_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 6e-96; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 6e-96
Query Start/End: Original strand, 20 - 221
Target Start/End: Original strand, 32612935 - 32613136
Alignment:
| Q |
20 |
ctctaccacttccatgtttaagtaagacatgatgccaaaggttttacgtaaccaaataacgtaagtggacatgacacagtacaattttatttaagcgtta |
119 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32612935 |
ctctaacacttccatgtttaagtaagacatgatgccaaaggttttacataaccaaataacgtaagtggacatgacacagtacaattttatttaagcgtta |
32613034 |
T |
 |
| Q |
120 |
attatttatcttttaagaattataaatatgtgatattaccattctggattttttgtgagttgctcacgaaaagaccataatgaaaacatcataaatttaa |
219 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||| |||||| |
|
|
| T |
32613035 |
attatttatcttttaagaattataaatatttgatattaccattctggattttttgtgagttgctcccgaaaagaccataatgaaaatatcatatatttaa |
32613134 |
T |
 |
| Q |
220 |
tt |
221 |
Q |
| |
|
|| |
|
|
| T |
32613135 |
tt |
32613136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 288 - 345
Target Start/End: Original strand, 32613171 - 32613228
Alignment:
| Q |
288 |
tcgcagctaatgactaaacctatgacaacacctctaccctaaatatgaataaaaactc |
345 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32613171 |
tcgcagctaatgactaaacctaagacaacacctctaccctaaatatgaataaaaactc |
32613228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University