View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20365_low_38 (Length: 285)
Name: NF20365_low_38
Description: NF20365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20365_low_38 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 14 - 206
Target Start/End: Original strand, 43037861 - 43038043
Alignment:
| Q |
14 |
tagtagagtaggaatgttcaattcaatttcagcttaagaaacacttctattctaagttctcactctttagtttacgtatcttttttatttggatgctttc |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
43037861 |
tagtagagtaggaatgttcaattcaatttcagcttaagaaacacttctattctaagttctcactcttta-----cgcatcttttttatttggatgctttc |
43037955 |
T |
|
| Q |
114 |
ccgggataatgattcaaaagatgatgcattgcatgttgccgttttgtttatagaaattattaaattttaaatggttggttaaataaatagtcc |
206 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43037956 |
ccgggataatgattaaaaagatgatgca-----tgttgccgttttgtttatagaaattattaaattttaaatggttggttaaataaatagtcc |
43038043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University