View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20365_low_46 (Length: 248)
Name: NF20365_low_46
Description: NF20365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20365_low_46 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 124 - 228
Target Start/End: Complemental strand, 52391245 - 52391141
Alignment:
| Q |
124 |
taaagaaaattatccatgtttgtaatatgatgattattttctactacctctttctgtcaacaattatatttattctcctcccttgttttcattcctaatg |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52391245 |
taaagaaaattatccatgtttgtaatatgatgattattttctactacctctttctgtcaacaattatatttattctcctcccttgttttcattcctaatg |
52391146 |
T |
 |
| Q |
224 |
accaa |
228 |
Q |
| |
|
||||| |
|
|
| T |
52391145 |
accaa |
52391141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 40
Target Start/End: Complemental strand, 52391541 - 52391502
Alignment:
| Q |
1 |
attagtgatattacaaaaactaatgatgattggaggctaa |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52391541 |
attagtgatattacaaaaactaatgatgattggaggctaa |
52391502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University