View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20365_low_55 (Length: 214)
Name: NF20365_low_55
Description: NF20365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20365_low_55 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 8052572 - 8052377
Alignment:
| Q |
1 |
gtaagatacatattttagcagaatattaatttaaaaaacagaaatttaatgattatttt-aatatgagatagagaaggagtaacagtaacagaactaacc |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
8052572 |
gtaagatacatattttagcagaatattaatttaaaaaacagaaatttaatgattatttttaatatgagatagagaaggagtaacag------aactaacc |
8052479 |
T |
|
| Q |
100 |
ttaatcccatctaaaaaatccatatctggaaacttgtctggttttgctcgatcaagcacctctgaattgcaatcaatgtcttcaaaaacaatgatagatc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8052478 |
ttaatcccatctaaaaaatccatatctggaaacttgtctggttttgctcgatcaagcacctctgaattgcaatcaatgtcttcaaaaacaatgatagatc |
8052379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University