View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20365_low_57 (Length: 208)
Name: NF20365_low_57
Description: NF20365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20365_low_57 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 16 - 190
Target Start/End: Original strand, 27939852 - 27940022
Alignment:
| Q |
16 |
aagaaaatttcccgtgtttgattattttccttcgcatacatgcatgcatgatatcttagtataaataaatatattgaactctacattaacatcccccatc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
27939852 |
aagaaaatttcccgtgtttgattattttccttcgcatacatg----catgatatctttgtataaataaatatattgaactctacattaacatgccccatc |
27939947 |
T |
|
| Q |
116 |
ctcaaaataaactatttacacaaataaaattaagctttcaagttcactaaaaatttcactacttaaagatgctta |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27939948 |
ctcaaaataaactatttacacaaataaaattaagctttcaagttcactaaaaatttcactacttaaagatgctta |
27940022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University