View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20367_high_19 (Length: 393)
Name: NF20367_high_19
Description: NF20367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20367_high_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 329 - 377
Target Start/End: Complemental strand, 28751729 - 28751681
Alignment:
| Q |
329 |
aagagcataataaagagtatgctcttcttgatcttttcaccttattcat |
377 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
28751729 |
aagagcataataaagagtatgctcttcttgatctttccaacttattcat |
28751681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 339 - 377
Target Start/End: Complemental strand, 28743357 - 28743319
Alignment:
| Q |
339 |
taaagagtatgctcttcttgatcttttcaccttattcat |
377 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28743357 |
taaagagtatgctcttcttgatcttttcaccttattcat |
28743319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University