View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20367_high_35 (Length: 313)
Name: NF20367_high_35
Description: NF20367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20367_high_35 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 2e-89; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 16 - 254
Target Start/End: Complemental strand, 3885301 - 3885062
Alignment:
| Q |
16 |
aaacacactgaataaacttctttaccaagtaattagacacactataaatttgtcacgtcgtgtaagttcggttccttccgtatgacaaaaccctatcgaa |
115 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||| |||||||||||| |
|
|
| T |
3885301 |
aaacacattgaataaacttctttaccaagtaattagacacactataaatttgtcacgtcgtggaagttcagttccttccgtatgactcaaccctatcgaa |
3885202 |
T |
|
| Q |
116 |
attgtgata--atggagtctctttgattttctatgagcttgtttgctcctgcttaaattaatcattgtcagctgataattctaagttttcatatgactgt |
213 |
Q |
| |
|
||||||||| |||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3885201 |
attgtgataatatggagtctctttgtttttctacgagcttgtttgctcctgcttaaattaatcattgtcagctgataattctaagttttcatatgactgt |
3885102 |
T |
|
| Q |
214 |
tttatnnnnnnnnnntcccaagcttacaccctctttctttc |
254 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |
|
|
| T |
3885101 |
tttat-aattttttttcccaagcttacaccctctttctttc |
3885062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 282 - 313
Target Start/End: Complemental strand, 3885034 - 3885003
Alignment:
| Q |
282 |
cgcacattgatgtatttcttttgaatgagaat |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
3885034 |
cgcacattgatgtatttcttttgaatgagaat |
3885003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University