View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20367_high_55 (Length: 236)

Name: NF20367_high_55
Description: NF20367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20367_high_55
NF20367_high_55
[»] chr4 (2 HSPs)
chr4 (7-130)||(2630726-2630850)
chr4 (126-221)||(2632112-2632207)


Alignment Details
Target: chr4 (Bit Score: 97; Significance: 8e-48; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 7 - 130
Target Start/End: Original strand, 2630726 - 2630850
Alignment:
7 tgggtagattattcttatgtttcatacggttctaaaatattagttgaactattctttt-tgtccttttttaagtaattaatgattatgtaataattatga 105  Q
    |||||| ||| |||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||    
2630726 tgggtaaatttttcttatgtttcatacggttctaaaatattagttgaactatttttttttgtccttttttaagtaattaatgattatgtaataattatga 2630825  T
106 aatcatatatttaaggtgaataatt 130  Q
    |||||||| || |||||||||||||    
2630826 aatcatattttcaaggtgaataatt 2630850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 126 - 221
Target Start/End: Original strand, 2632112 - 2632207
Alignment:
126 taattaagtggggtgtttcaagttttatcttcgacccctacatatgtaatgtcattgtgttatttgactaattttctaggattgtaacaaaattgg 221  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
2632112 taattaagtggggtgtttcaagttttatcttggacccctacatatgtaatgtcattgtgttatttgacgaattttctaggattgtaacaaaattgg 2632207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University