View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20367_low_33 (Length: 342)
Name: NF20367_low_33
Description: NF20367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20367_low_33 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 18 - 328
Target Start/End: Complemental strand, 52243067 - 52242763
Alignment:
| Q |
18 |
gttagcaaagaaacaaagtattgctgaaagaaaaggacagaagccnnnnnnnnnnnngtagaatgagaggctgtggtgtgttcattttgatttcagttac |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52243067 |
gttagcaaagaaacaaagtattgctgaaagaaaaggacagaagccagagag------gtagaatgagaggctgtggtgtgttcattttgatttcagttac |
52242974 |
T |
|
| Q |
118 |
aatatgtagacatttgatttatttagtatcacaaattattcacactttatccatattgtattatgtggttttgcaatttctactagatttccattgccac |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
52242973 |
aatatgtagacatttgatttatttagtatcacaaattattcacactttatccatattgtattatgtggttttgcaatttctactagatttccagtgccac |
52242874 |
T |
|
| Q |
218 |
ctaactctgtcctcggtgacaattcaaattattatcatttcaaaattctcttcactgacatcattgttctttctcacaaacctctcagttcagttcagtt |
317 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52242873 |
ctaactctgtccttggtgacaattcaaattattattatttcaaaattctcttcactgacatcattgttctttctcacaaacctctcagttcagttcagtt |
52242774 |
T |
|
| Q |
318 |
ctgttctgttc |
328 |
Q |
| |
|
||||||||||| |
|
|
| T |
52242773 |
ctgttctgttc |
52242763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University