View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20367_low_41 (Length: 300)
Name: NF20367_low_41
Description: NF20367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20367_low_41 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 13 - 206
Target Start/End: Original strand, 2630392 - 2630586
Alignment:
| Q |
13 |
gaatacgaattgtca-taacataatttgtgaacccataccactaaggctgtatttcaaaagaatagatagatgattacaaaaacaaagttaaccaccggt |
111 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2630392 |
gaatacgaattgtcaataacataatttgtgaaccgataccactaaggctgtatttcaaaagaatagatagatgattacaaaaacaaagttaaccaccggt |
2630491 |
T |
 |
| Q |
112 |
gtaaaatagtagattgagattgcaactccagcatatgacataatctaccttcggaaagtcaaaaatcactcggtgacatgactaattcagattaa |
206 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2630492 |
gtaaaagagtagattgagattgcaactccagcatatgacataatctaccttcggaaagtcaaaaatcactcggtgacatgactaattcagattaa |
2630586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 230 - 300
Target Start/End: Original strand, 2630689 - 2630759
Alignment:
| Q |
230 |
atggtttgtagggctaaaaatataactgttaaggtgttgggtaaatttttcttatgtttcatacggttcta |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2630689 |
atggtttgtagggctaaaaatataactgttaaggtgttgggtaaatttttcttatgtttcatacggttcta |
2630759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University