View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20367_low_52 (Length: 243)
Name: NF20367_low_52
Description: NF20367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20367_low_52 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 22 - 234
Target Start/End: Complemental strand, 1179266 - 1179043
Alignment:
| Q |
22 |
atgttgtgcaggttattttccccatgaattttaataaaattccaaaatgatttctgaatatgaaaattgttgatcacactagtctttctgagatcatttc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1179266 |
atgttgtgcaggttattttccccatgaattttaataaaattccaaaatgatttctgaataagaaaattcttgatcacactagtctttctgagatcatttc |
1179167 |
T |
 |
| Q |
122 |
gcag-----------tcatctaatgatcgagaattttcaacttcattgattttgaagatcagattccttaacccctaacaatttcatgcattaaaacatg |
210 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1179166 |
gcaggctaaattaactcatctaatgatcgagaattttcaatttcattgattttgtagatcagattccttaacccctaacaatttcatgcattaaaacatg |
1179067 |
T |
 |
| Q |
211 |
attcattcatgagtataatctacc |
234 |
Q |
| |
|
||||||||||||||| |||||||| |
|
|
| T |
1179066 |
attcattcatgagtagaatctacc |
1179043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 62 - 108
Target Start/End: Original strand, 35029201 - 35029247
Alignment:
| Q |
62 |
tccaaaatgatttctgaatatgaaaattgttgatcacactagtcttt |
108 |
Q |
| |
|
|||||||||| || |||||||||||||| | |||||||||||||||| |
|
|
| T |
35029201 |
tccaaaatgacttttgaatatgaaaattctcgatcacactagtcttt |
35029247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University