View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20367_low_53 (Length: 239)
Name: NF20367_low_53
Description: NF20367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20367_low_53 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 46 - 226
Target Start/End: Complemental strand, 41130682 - 41130501
Alignment:
| Q |
46 |
gttctcctgaataatttatcgttgttattgatttattccgannnnnnn-aaatttcacttatattattagtttccttttcaattttatgggtttggcatg |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41130682 |
gttctcctgaataatttatcgttgttattgatttattccgaaattttttaaatttcacttatattattagtttccttttcaattttatgggtttggcatg |
41130583 |
T |
|
| Q |
145 |
tgcaacagatggggtcgcaccttggccaaattttgtgttttattatgaacctatgtatagaaaaacaaaagttgttgttagt |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41130582 |
tgcaacagatggggtcgcaccttggccaaattttgtgttttattatgaacctatgtatagaaaaacaaaagttgttgttagt |
41130501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University