View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20367_low_56 (Length: 237)
Name: NF20367_low_56
Description: NF20367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20367_low_56 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 13564787 - 13564573
Alignment:
| Q |
1 |
aaatttatatttttcaataatgcaactttcttgtagatttattttaaaagcctcttcttaatttaattaggagagctaacatatgaagaaagtctatcgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13564787 |
aaatttatatttttcaataatgcaactttcttgtagatttattttaaaaacctcttcttaatttaattaggagagctaacatatgaagaaagtctatcgg |
13564688 |
T |
|
| Q |
101 |
tacacttttcaatttaaagtttataggtaaactattaattttcaattttctattgactgagttttattaaaactttcaattttcaaaactttcttagaaa |
200 |
Q |
| |
|
||||||||| | ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13564687 |
tacactttttattttaaagttta-aggtaaactattaattttcaattttctattgactgagttttattaaaactttcaattttcaaaactttcttagaaa |
13564589 |
T |
|
| Q |
201 |
gagatggaacaatgtt |
216 |
Q |
| |
|
||||||||| |||||| |
|
|
| T |
13564588 |
gagatggaaaaatgtt |
13564573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University