View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20367_low_58 (Length: 236)
Name: NF20367_low_58
Description: NF20367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20367_low_58 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 97; Significance: 8e-48; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 7 - 130
Target Start/End: Original strand, 2630726 - 2630850
Alignment:
| Q |
7 |
tgggtagattattcttatgtttcatacggttctaaaatattagttgaactattctttt-tgtccttttttaagtaattaatgattatgtaataattatga |
105 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2630726 |
tgggtaaatttttcttatgtttcatacggttctaaaatattagttgaactatttttttttgtccttttttaagtaattaatgattatgtaataattatga |
2630825 |
T |
 |
| Q |
106 |
aatcatatatttaaggtgaataatt |
130 |
Q |
| |
|
|||||||| || ||||||||||||| |
|
|
| T |
2630826 |
aatcatattttcaaggtgaataatt |
2630850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 126 - 221
Target Start/End: Original strand, 2632112 - 2632207
Alignment:
| Q |
126 |
taattaagtggggtgtttcaagttttatcttcgacccctacatatgtaatgtcattgtgttatttgactaattttctaggattgtaacaaaattgg |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2632112 |
taattaagtggggtgtttcaagttttatcttggacccctacatatgtaatgtcattgtgttatttgacgaattttctaggattgtaacaaaattgg |
2632207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University