View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20367_low_61 (Length: 226)
Name: NF20367_low_61
Description: NF20367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20367_low_61 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 77; Significance: 7e-36; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 41 - 166
Target Start/End: Original strand, 2928489 - 2928618
Alignment:
| Q |
41 |
caactagtctgtcaatctctggtgtactgtttcggcagtttttcagtttcttagatttgtgtattggagctgttctattgcgtttttcgtagta----ta |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| ||||||||| ||||||| ||||| | |
|
|
| T |
2928489 |
caactagtctgtcaatctctggtgtactgtttgggcggtttttcagtttcttagatttgtgtattggagttgttctattttgtttttcttagtatcagtc |
2928588 |
T |
|
| Q |
137 |
agttagttgatcgggtacctttgaggtttg |
166 |
Q |
| |
|
|||| |||||||| |||||||||||||||| |
|
|
| T |
2928589 |
agttggttgatcgagtacctttgaggtttg |
2928618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 87 - 143
Target Start/End: Complemental strand, 3002773 - 3002717
Alignment:
| Q |
87 |
tttcttagatttgtgtattggagctgttctattgcgtttttcgtagtataagttagt |
143 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
3002773 |
tttcttatatttgtgtattggagctgttctattgcgtttttcttagtatcagttagt |
3002717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 80 - 120
Target Start/End: Complemental strand, 37200292 - 37200252
Alignment:
| Q |
80 |
ttttcagtttcttagatttgtgtattggagctgttctattg |
120 |
Q |
| |
|
||||||||||||||| |||||||||||| |||| ||||||| |
|
|
| T |
37200292 |
ttttcagtttcttagttttgtgtattggggctgctctattg |
37200252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University