View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20368_high_5 (Length: 249)
Name: NF20368_high_5
Description: NF20368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20368_high_5 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 33 - 249
Target Start/End: Complemental strand, 8044938 - 8044723
Alignment:
| Q |
33 |
gtgcacctaaacctttatatttgaaaccacaaatttatttttcctttcccttttatgcttacaagtttttgatttatagtggtagagtatatcctttatt |
132 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8044938 |
gtgcacctaaacctttatattttaaaccacaatttt-tttttcctttcccttttatgcttacaagtttttgatttatagtggtagagtatatcctttatt |
8044840 |
T |
|
| Q |
133 |
agcataatacagctggggtgccgccacaaacagctgtaacgttagcttcaacaatccctttcttgctttccactaatggttccttccttttctacatcct |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8044839 |
agcataatacagctggggtgccgccacaaacagctgtaacgttggcttcaacaatccctttcttgctttccactaatggttccttccttttctacatcct |
8044740 |
T |
|
| Q |
233 |
tcttgcatccaattccc |
249 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
8044739 |
tcttgcatccaattccc |
8044723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 154 - 249
Target Start/End: Complemental strand, 8037613 - 8037517
Alignment:
| Q |
154 |
cgccacaaacagctgt-aacgttagcttcaacaatccctttcttgctttccactaatggttccttccttttctacatccttcttgcatccaattccc |
249 |
Q |
| |
|
|||||||||||||||| || ||| ||||||||||||| |||||| | |||||||| ||| ||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
8037613 |
cgccacaaacagctgtgaaggttggcttcaacaatccttttcttacattccactattggctccttgcttttctacatacttcttgcatccaattccc |
8037517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University