View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20369_high_27 (Length: 225)
Name: NF20369_high_27
Description: NF20369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20369_high_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 98 - 207
Target Start/End: Complemental strand, 52764586 - 52764477
Alignment:
| Q |
98 |
tcttctgggtactaacaagtccattattccaacatgtttaactggtacctcaaaataggccccatattgagtacttttgagatgtcnnnnnnngtccgaa |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
52764586 |
tcttctgggtactaacaagtccattattccaacatgtttaactggtacctcaaaataggccccatattgagtacttttgagatgtctttttttgtccgaa |
52764487 |
T |
|
| Q |
198 |
gttttgaatt |
207 |
Q |
| |
|
|||||||||| |
|
|
| T |
52764486 |
gttttgaatt |
52764477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 138 - 181
Target Start/End: Complemental strand, 52770536 - 52770493
Alignment:
| Q |
138 |
actggtacctcaaaataggccccatattgagtacttttgagatg |
181 |
Q |
| |
|
|||||||| | ||||||||||||||| ||||||||||||||||| |
|
|
| T |
52770536 |
actggtacttaaaaataggccccatactgagtacttttgagatg |
52770493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University