View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20369_high_28 (Length: 219)
Name: NF20369_high_28
Description: NF20369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20369_high_28 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 13 - 201
Target Start/End: Original strand, 45467121 - 45467305
Alignment:
| Q |
13 |
cagagagatcaagagaattttgaagatgacaatcgcgaattcaagaaaaggttggtctcttaggcagaatgatactctttgggcttatagaacaacttac |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
45467121 |
cagagagatcaagagaattttgaagatgacaatcgcgaattcaagaaaaggttggtctcttaggcagaatggtactctttgggcttatagaacaacttac |
45467220 |
T |
|
| Q |
113 |
aaagcccatattggtttaagactgattcaaatggtctatgccagagcatactatcatttactggtagaactataataaatggttcattg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
45467221 |
aaagcccatattggtttaagactgattcaaatggtctatgccagagca---tatcatttactggtagaac-ataataaatggttcattg |
45467305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University