View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20369_low_18 (Length: 277)
Name: NF20369_low_18
Description: NF20369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20369_low_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 247; Significance: 1e-137; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 7 - 261
Target Start/End: Original strand, 33236614 - 33236868
Alignment:
| Q |
7 |
agcacagacacatacatagacaccgaatacaacatggacaccgacatggtcatataaatagattttggagcactaacatttttattggtttaccaaatga |
106 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33236614 |
agcacggacacagacatagacaccgaatacaacatggacaccgacatggtcatataaatagattttggagcactaacatttttattggtttaccaaatga |
33236713 |
T |
 |
| Q |
107 |
atcacagacaaggctagcagaaagcagagctgaattcgagccagaatttcgcacactgaagctgatttcttgtcaggttaattatttgatgacataatca |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33236714 |
atcacagacaaggctagcagaaagcagagctgaattcgagccagaatttcgcacactgaagctgatttcttgtcaggttaattatttgatgacataatca |
33236813 |
T |
 |
| Q |
207 |
taattaatcacactactttatttctataattttattaaattatatgatatgtatc |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33236814 |
taattaatcacactactttatttctataattttattaaattatatgatatgtatc |
33236868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 147 - 193
Target Start/End: Original strand, 33221018 - 33221063
Alignment:
| Q |
147 |
ccagaatttcgcacactgaagctgatttcttgtcaggttaattattt |
193 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33221018 |
ccagaatttcctacactgaagctgatttcttgtcagg-taattattt |
33221063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University