View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20369_low_20 (Length: 259)
Name: NF20369_low_20
Description: NF20369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20369_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 11 - 248
Target Start/End: Complemental strand, 43615058 - 43614821
Alignment:
| Q |
11 |
gagatatatattggaaaaactgaaaattggaattacattacatgatagaaaagaataaagaaaggcatggcatgacatgtttaaagttgagtttagctta |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43615058 |
gagatatatattggaaaaactgaaaattggaattacattacatgatagaaaagaataaagaaaggcatggcatgacatgtttaaagttgagtttagctta |
43614959 |
T |
 |
| Q |
111 |
ggatgctgccatggttgatggccttacggagaagagcctgacgtccggggaatggattgacaatggctgtattaatgttgtcatcttcaacttcttcaat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43614958 |
ggatgctgccatggttgatggccttacggagaagagcctgacgtccggggaatggattgacaatggctaaattaatgttgtcatcttcaacttcttcaat |
43614859 |
T |
 |
| Q |
211 |
atcaaccacattgtcgtccttctgttgttgtgcttcat |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43614858 |
atcaaccacattgtcgtccttctgttgttgtgcttcat |
43614821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University