View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20369_low_30 (Length: 227)
Name: NF20369_low_30
Description: NF20369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20369_low_30 |
 |  |
|
| [»] scaffold1787 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 59; Significance: 4e-25; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 116 - 213
Target Start/End: Original strand, 21205635 - 21205733
Alignment:
| Q |
116 |
aaattcagcaataaaagagtgaaccttaatgtcaa-ggtatgcatcggaaatgggaagatggttattgttgcatttatgattggtaaaggttaagaact |
213 |
Q |
| |
|
|||| ||||||| ||| ||||||||||||||||| ||||||||||||||| |||||| ||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
21205635 |
aaatgcagcaatgaaatggtgaaccttaatgtcaaaggtatgcatcggaaaagggaagttggttattgttgcatttgtgattgataaaggttaagaact |
21205733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 19 - 86
Target Start/End: Original strand, 21117529 - 21117597
Alignment:
| Q |
19 |
ggatccactcaaaaattaattattgaatcaagtacttttt-gggtacaaagtatacaaccaaatatatg |
86 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
21117529 |
ggatccactcaaaaattaattattgaatctagtactttttggggtacaaagtatacaaccaaatatatg |
21117597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 120 - 196
Target Start/End: Original strand, 21305699 - 21305776
Alignment:
| Q |
120 |
tcagcaataaaagagtgaaccttaatgtc-aaggtatgcatcggaaatgggaagatggttattgttgcatttatgatt |
196 |
Q |
| |
|
|||| |||||||| ||||||||||||||| ||||| |||||| ||||||||||| |||| ||||||||||| ||||| |
|
|
| T |
21305699 |
tcagaaataaaagggtgaaccttaatgtctaaggtgtgcatcagaaatgggaagttggtacttgttgcatttgtgatt |
21305776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1787 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: scaffold1787
Description:
Target: scaffold1787; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 113 - 197
Target Start/End: Complemental strand, 1338 - 1253
Alignment:
| Q |
113 |
cacaaattcagcaataaaagagtgaaccttaatgtc-aaggtatgcatcggaaatgggaagatggttattgttgcatttatgattg |
197 |
Q |
| |
|
||||||| | |||||||||| ||||||||||||||| ||| | |||||| ||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
1338 |
cacaaatgcggcaataaaagggtgaaccttaatgtccaagctgtgcatcagaaatgggaagttggttattgttgcatttgtgattg |
1253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 25 - 81
Target Start/End: Complemental strand, 21659051 - 21658993
Alignment:
| Q |
25 |
actcaaaaattaattattgaatcaagtact--ttttgggtacaaagtatacaaccaaat |
81 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||| |||||||||||||||| ||||| |
|
|
| T |
21659051 |
actcaataattaattattgaatcaagtactttttttaggtacaaagtatacaatcaaat |
21658993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University