View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20369_low_31 (Length: 225)

Name: NF20369_low_31
Description: NF20369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20369_low_31
NF20369_low_31
[»] chr4 (2 HSPs)
chr4 (98-207)||(52764477-52764586)
chr4 (138-181)||(52770493-52770536)


Alignment Details
Target: chr4 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 98 - 207
Target Start/End: Complemental strand, 52764586 - 52764477
Alignment:
98 tcttctgggtactaacaagtccattattccaacatgtttaactggtacctcaaaataggccccatattgagtacttttgagatgtcnnnnnnngtccgaa 197  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||    
52764586 tcttctgggtactaacaagtccattattccaacatgtttaactggtacctcaaaataggccccatattgagtacttttgagatgtctttttttgtccgaa 52764487  T
198 gttttgaatt 207  Q
    ||||||||||    
52764486 gttttgaatt 52764477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 138 - 181
Target Start/End: Complemental strand, 52770536 - 52770493
Alignment:
138 actggtacctcaaaataggccccatattgagtacttttgagatg 181  Q
    |||||||| | ||||||||||||||| |||||||||||||||||    
52770536 actggtacttaaaaataggccccatactgagtacttttgagatg 52770493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University