View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2036_high_7 (Length: 325)
Name: NF2036_high_7
Description: NF2036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2036_high_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 11 - 309
Target Start/End: Original strand, 1862883 - 1863181
Alignment:
| Q |
11 |
atgaagcgtgttattactgatcgagatgttgatatggtaattaatgattttatcactctttagtgatttgaatatgtgaagaattcttcatctttttcca |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1862883 |
atgaagcgtgttattactgatcgagatgttgatatggtaattaatgattttatctctctttagtgatttgaatatgtgaagaattcttcatctttttcca |
1862982 |
T |
 |
| Q |
111 |
ctgtttctctaaaaaacaatgttttgattagtgtgtaagtaaatatagtcattatttttatctttgccttctttatttcacgtgctcttcttatatttat |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1862983 |
ttgtttctctaaaaaacaatgttttgattagtgtgtaagtaaatatagtcattatttttatctttgccttctttatttcacgtgctcttcttatatttat |
1863082 |
T |
 |
| Q |
211 |
tttcattataaaaaataatgggaatgtccttaacgagtattgttttattaaggttgttgagaatatatatatggattagagaattgcacttatgggtta |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1863083 |
tttcattataaaaaataatgggaatgtccttaacgagtattgttttattaaggttgttgagaatatatatatggattagagaattgcacttatgggtta |
1863181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University