View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2036_high_9 (Length: 257)
Name: NF2036_high_9
Description: NF2036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2036_high_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 19 - 247
Target Start/End: Complemental strand, 6588819 - 6588591
Alignment:
| Q |
19 |
aactctcctcctagtgttgttcatcatgaagaagagaagccactgaaaattgttcacaaaattggggtggagtcgaagaagctatggaaaatagccggtc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6588819 |
aactctcctcctagtgttgttcatcatgaagaagagaagccactgaaaattgttcacaaaattggggtggagtcgaagaagctatggaaaatagccggtc |
6588720 |
T |
|
| Q |
119 |
caacaatcttaacttctttatctcagtactcgcttggtgcattcacttctacgtttgttggccatgttaacgagctcgatcttgcagctttttctgttga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6588719 |
caacaatcttaacttctttatctcagtactcgcttggtgcattcacttctacgtttgttggccatgttaacgagctcgatcttgcagctttttctgttga |
6588620 |
T |
|
| Q |
219 |
aaattctgttattgctggtttcgcctttg |
247 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6588619 |
aaattctgttattgctggtttcgcctttg |
6588591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University