View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2036_low_15 (Length: 237)
Name: NF2036_low_15
Description: NF2036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2036_low_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 18 - 195
Target Start/End: Complemental strand, 43225019 - 43224849
Alignment:
| Q |
18 |
aattgtgtgttgattggttgctgcattgttttgaggtattaggcttgttcaaggtatgtatgtttggattttcatggcctttggaattgttccatgctat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
43225019 |
aattgtgtgttgattggttgctgcattgttttgaggtattaggcttgttcaaggtatgtatgtttggattttcatggcctttggaattgttccatgc--t |
43224922 |
T |
|
| Q |
118 |
agtgcagattttttctctcatactgtgctctcnnnnnnnnnncttctcgctctttatcctattatacaactctttctt |
195 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43224921 |
agtgcagattttttctctcttactgtgctct-----tttttttttctcgctctttatcctgttatacaactctttctt |
43224849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University