View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2036_low_16 (Length: 237)
Name: NF2036_low_16
Description: NF2036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2036_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 2 - 223
Target Start/End: Original strand, 5576408 - 5576631
Alignment:
| Q |
2 |
tctatgggcaatggattgaaacaatgtcaaaaagaaaacaaaacgcagtagttggagagatgttaaaatggcgaagagatcatcaaca--tgattggaag |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| || |
|
|
| T |
5576408 |
tctatgggcaatggattgaaacaatgtcaaaaagaaaacaaaacgcagtagttggagagatgttaaaatggcgatgagatcatcaacacatgattggtag |
5576507 |
T |
 |
| Q |
100 |
agcagttcaaacataaagttgtgttgtgcataacctttaatttaaaatgagggaactttgttaaaagtatcagatttaaagatcagagatatagtctaat |
199 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5576508 |
agcagttcaaacataaagttgtgttatgcataacctttaatttaaaatgagggaactttgttaaaagtatcagatttaaagatcagagatatagtctaat |
5576607 |
T |
 |
| Q |
200 |
tctaacgcatggacataattagtg |
223 |
Q |
| |
|
||||||||||| |||||||||||| |
|
|
| T |
5576608 |
tctaacgcatgaacataattagtg |
5576631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University