View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2036_low_17 (Length: 235)
Name: NF2036_low_17
Description: NF2036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2036_low_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 3 - 219
Target Start/End: Original strand, 2137732 - 2137948
Alignment:
| Q |
3 |
aatcaaattcataacattttagaaatcataaagtttaacatatctcaccgactgtttggttgagttgatcacagtagcatcggatgactcttgaaacggc |
102 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2137732 |
aatcaaattcataaaattttagaaatcatcaagtttaacatatctcaccgactgtttggttgagttgatcacagtagcatgggatgactcttgaaacggc |
2137831 |
T |
 |
| Q |
103 |
gtgttcccttgctgaagtgtctcaaaggccttcgtaagtcgatctatctcagctaggacttctaagtggttttttgccactgtttcagtgatgcgattca |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2137832 |
gtgttcccttgctgaagtgtctcaaaggccttcgtaagtcgatctatctcggctaggacttctaagtggttttttgccactgtttcagtgatgcgattca |
2137931 |
T |
 |
| Q |
203 |
atccagcttctagttct |
219 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
2137932 |
atccagcttctagttct |
2137948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University