View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2036_low_19 (Length: 210)
Name: NF2036_low_19
Description: NF2036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2036_low_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 1 - 186
Target Start/End: Complemental strand, 48604202 - 48604017
Alignment:
| Q |
1 |
gaaaagattatgagttcacaacatcctctcttcttcaccgtggctttcgatcctaaatatcatgttttgcaattctcaagtaattcacggtcaaagtttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48604202 |
gaaaagattatgagttcacaacatcctctcttcttcaccgtggctttcgatcctaaatatcatgttttgcaattctcaagtaattcacggtcaaagtttc |
48604103 |
T |
|
| Q |
101 |
acaaccattttgtatatcttttaatatatgctttgattttgaattttgttactttctcatcgcatatttcaatgttttcatctagt |
186 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
48604102 |
acaaccattttgtatttcttttaatatatgctttgattttgaattttgttactttttcatcgcatatttcaatgttttcatctagt |
48604017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University