View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20370_high_5 (Length: 219)
Name: NF20370_high_5
Description: NF20370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20370_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 43928415 - 43928220
Alignment:
| Q |
1 |
ccgttgcaggttgcgcgcagttagttggtttgtgaagaagttccattccaactctgcaaaaccaaaaatccttttannnnnnnatataacttttctttaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43928415 |
ccgttgcaggttgcgcgcagttagttggtttgtgaagaagttccattccaactctgcaaaaccaaaaatccttttattttt--atataacttttctttaa |
43928318 |
T |
 |
| Q |
101 |
tatgttttgatttcaatccttgttcttgttttacatttccttctggtttttatctccgcttcatatctctctcttggtttggtgctcattgttgttaa |
198 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43928317 |
tatgttttgatttcaatccttcttcttgttttacatttccttctggtttttatctccgcttcatatttctctcttggtttggtgctcattgttgttaa |
43928220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University