View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20370_low_4 (Length: 282)
Name: NF20370_low_4
Description: NF20370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20370_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 89; Significance: 6e-43; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 18 - 114
Target Start/End: Complemental strand, 2420247 - 2420151
Alignment:
| Q |
18 |
tctaggattggatctgttttagggtgtggatttcttatgcttgctctagtgaagttatgcagattaagcttgggactgtagcttgtgggagtcaaca |
114 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2420247 |
tctaggattggatttgttttagggtgtgggtttcttatgcttgctctagtgaagttatgcagattaagcttgggactgtagcttgtgggagtcaaca |
2420151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 18 - 114
Target Start/End: Complemental strand, 10615394 - 10615298
Alignment:
| Q |
18 |
tctaggattggatctgttttagggtgtggatttcttatgcttgctctagtgaagttatgcagattaagcttgggactgtagcttgtgggagtcaaca |
114 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
10615394 |
tctaggattggatctgttttagggtgtgggtttcttatgcttgctctagtgaagttatgcagattaaggttgggactgtagcttgtgggagtcaaca |
10615298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 199 - 267
Target Start/End: Complemental strand, 10615213 - 10615145
Alignment:
| Q |
199 |
tcattaggtttggataaaatcattgttgttcaattcaaccagagtgctttgtttatggttgaagatgat |
267 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
10615213 |
tcattaggtttggatgaaatcattgttgttcaattcaaccagagtgctttgtttgtggttgaagatgat |
10615145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 198 - 267
Target Start/End: Complemental strand, 2420067 - 2419998
Alignment:
| Q |
198 |
ctcattaggtttggataaaatcattgttgttcaattcaaccagagtgctttgtttatggttgaagatgat |
267 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2420067 |
ctcattagatttggatgaaatcattgttgttcaattcaaccagagtgctttgtttgtggttgaagatgat |
2419998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 81; Significance: 4e-38; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 18 - 114
Target Start/End: Original strand, 46469918 - 46470014
Alignment:
| Q |
18 |
tctaggattggatctgttttagggtgtggatttcttatgcttgctctagtgaagttatgcagattaagcttgggactgtagcttgtgggagtcaaca |
114 |
Q |
| |
|
|||| |||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
46469918 |
tctaagattggatttgttttagggtgtgggtttcttatgcttgctctagtgaagttatgcagattaagattgggactgtagcttgtgggagtcaaca |
46470014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 198 - 270
Target Start/End: Original strand, 46470082 - 46470154
Alignment:
| Q |
198 |
ctcattaggtttggataaaatcattgttgttcaattcaaccagagtgctttgtttatggttgaagatgatatt |
270 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
46470082 |
ctcattaggtgtggatgaaatcattgttgttcaattcaaccagagtgctttatttgtggttgaagatgatatt |
46470154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 54; Significance: 5e-22; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 22 - 114
Target Start/End: Complemental strand, 31125285 - 31125192
Alignment:
| Q |
22 |
ggattggatctgttttagggtgtggatttcttatgcttgctctagtgaa-gttatgcagattaagcttgggactgtagcttgtgggagtcaaca |
114 |
Q |
| |
|
|||||||||||||||| || |||| ||||||||||||||| ||||||| ||| |||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
31125285 |
ggattggatctgttttgggatgtgcgtttcttatgcttgctttagtgaatgttgtgcagattaaacttgggactgttgcttgtgggagtcaaca |
31125192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University