View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20370_low_5 (Length: 260)
Name: NF20370_low_5
Description: NF20370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20370_low_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 101 - 243
Target Start/End: Complemental strand, 3002438 - 3002296
Alignment:
| Q |
101 |
ttggtactttcagtaggtctggttctgctctgcggagtattggttttatggttgtcgttggggcgtgctcagccttagtcagctgatgagaggtgttgtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| ||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3002438 |
ttggtactttcagtaggtctggttctactctgcggggtattggttttctggttgtcgtcggggcgtgctcagccttagtcagctgatgagaggtgttgtg |
3002339 |
T |
|
| Q |
201 |
ttgctgcaatttttatttggtcgcttttgcaaggtgtgtgttt |
243 |
Q |
| |
|
||||||||||||||||||||| | |||| |||||||||||||| |
|
|
| T |
3002338 |
ttgctgcaatttttatttggttgttttttcaaggtgtgtgttt |
3002296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 101 - 237
Target Start/End: Complemental strand, 3010824 - 3010688
Alignment:
| Q |
101 |
ttggtactttcagtaggtctggttctgctctgcggagtattggttttatggttgtcgttggggcgtgctcagccttagtcagctgatgagaggtgttgtg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||| | ||||| |||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
3010824 |
ttggtactttcagtaggtctggttctgctctgcggggtattggttatctggttatcgttggggcgtgctcagtcttagtccgctgatgagaggtgttgtg |
3010725 |
T |
|
| Q |
201 |
ttgctgcaatttttatttggtcgcttttgcaaggtgt |
237 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
3010724 |
ttgctgcaatttttatttggttgtttttgcaaggtgt |
3010688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University