View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20371_high_17 (Length: 215)
Name: NF20371_high_17
Description: NF20371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20371_high_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 28 - 203
Target Start/End: Original strand, 40767972 - 40768147
Alignment:
| Q |
28 |
aacaatctccgacgaattgtctcaattcaaggagagccttcccaaagaattgcagcctatatggtggagggactcgccgctcgcctcgctgaatccggaa |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40767972 |
aacaatctccgacgaattgtctcaattcaaggagagccttcccaaagaattgcagcctatatggtggagggactcgccgctcgcctcgctgaatccggaa |
40768071 |
T |
|
| Q |
128 |
aaagtatttatagagctttgaaatgcaaggaacctccttcttcagaccgtctagcagcgatgcagatattcttcga |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
40768072 |
aaagtatttatagagctttgaaatgcaaggaacctccttcttcggaccgtctagcagcgatgcagatattgttcga |
40768147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 63; Significance: 1e-27; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 49 - 195
Target Start/End: Complemental strand, 10093785 - 10093639
Alignment:
| Q |
49 |
tcaattcaaggagagccttcccaaagaattgcagcctatatggtggagggactcgccgctcgcctcgctgaatccggaaaaagtatttatagagctttga |
148 |
Q |
| |
|
|||||||| ||||| ||||| | |||||||||||||| |||||||| ||||| || ||||| | ||| ||| |||||| ||||||||| |||||||| |
|
|
| T |
10093785 |
tcaattcagggagaaccttcggatagaattgcagcctacatggtggaaggacttgctgctcgtttggcttcatcgggaaaatgtatttataaagctttga |
10093686 |
T |
|
| Q |
149 |
aatgcaaggaacctccttcttcagaccgtctagcagcgatgcagata |
195 |
Q |
| |
|
|||||||||||||||| ||||| || ||||||||||| ||||||||| |
|
|
| T |
10093685 |
aatgcaaggaacctccgtcttctgatcgtctagcagcaatgcagata |
10093639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University